cover
Article Per Year (5 Year)
All
Home Page
OAI Link
Editorial Team
Contact
Reviewer
Google Scholar
Contact Name
I G. Made Krisna Erawan
Contact Email
krisnaerawan@unud.ac.id
Phone
-
Journal Mail Official
-
Editorial Address
Animal Hospital, Faculty of Veterinary Medecine Building, Udayana University, 2nd Floor, Jalan Raya Sesetan, Gang Markisa No 6, Banjar Gaduh, Sesetan, Denpasar, Bali, Indonesia
Location
Kota denpasar,
Bali
INDONESIA
Jurnal Veteriner
Published by Universitas Udayana
ISSN : 14118327     EISSN : 24775665     DOI : https://doi.org/10.19087/jveteriner
Core Subject : Health,
Veterinary
Jurnal Veteriner memuat naskah ilmiah dalam bidang kedokteran hewan. Naskah dapat berupa: hasil penelitian, artikel ulas balik (review), dan laporan kasus. Naskah harus asli (belum pernah dipublikasikan) dan ditulis menggunakan bahasa Indonesia atau bahasa Inggris. Naskah ilmiah yang telah diseminarkan dalam pertemuan ilmiah nasional dan internasional, hendaknya disertai dengan catatan kaki
Arjuna Subject : -
Articles 16 Documents
 1   2 
Search results for , issue "Vol 13 No 4 (2012)" : 16 Documents clear
Aplikasi Kandidat Pemindai untuk Diagnosis Gen Shiga like toxin-2 dari Escherichia coli O157:H7 (PROBE APLICATION TO DIAGNOSTIC PROGRAME OF SHIGA LIKE TOXIN-2 (STX2) GEN FROM ESCHERICHIA COLI O157:H7) I Wayan Suardana; I Nengah Sujaya; Wayan Tunas Artama
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (145.367 KB)

Abstract

A Shiga-like toxin producing Escherichia coli O157:H7 has been detected in cattle fecal sample, atbeef, and human as well as in beef and indicating that the agent is a harmful zoonosis bacteria. Geneticanalysis of Shiga toxin Escherichia coli (STEC) gene is important for development of probe to improve thediagnosis method for the agent. The study consisted of degrading and synthezing of PS2 probe withnucleotide sequence, 5’TTACACATATATCAGTGCCCGGTGTGA-CAACGGTTTCCATGACAACGGACAGCAGTTATACCACTCTGCAACGTGTCGCAGCGCTGGAA-CGTTCCGGAATGCAAATCAGTCGTCA‘3, analyzing of labeled probe, extracting of genomic DNA, hybridizing dot-blot DNA-DNA, and finallydetecting of hybridization signal. The results show that PS2 probe can be used to detect Shiga like toxingene (stx2 gene) from E. coli O157:H7. The Probe has labeling efficiency up to 10 pg/?l. PS2 probe with 25ng/ml concentration has a capability to detect it’s complemantary in 10 ng/?l DNA samples concentration.
Keragaman Genetik Sekuen Gen ATP Synthase FO Subunit 6 (ATP6) Monyet Hantu (Tarsius) Indonesia (GENETIC DIVERSITY STUDY OF ATP6 GENE SEQUENCES OF TARSIERS FROM INDONESIA) Rini Widayanti; Niken Satuti Nur Handayani; Hery Wijayanto
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (197.212 KB)

Abstract

In a conservation effort, the identification of Tarsier species, on the bases of the morphological andmolecular characteristic is necessary. Up to now, the identification of the animals were based on themorphology and vocalizations, which is extremely difficult to identify each, tarsier species. The objective ofthis research was to study the genetic diversity on ATP6 gene of Tarsius sp. Based on sequencing of PCRproduct using primer ATP6F and ATP6R with 681 nts. PCR product. The sequence of ATP6 fragmentswere aligned with other primates from Gene bank with aid of software Clustal W, and were analyzed usingMEGA program version 4.0. Three different nucleotide sites were found (nucleotide no. 288, 321 and 367).The genetic distance based on nucleotide ATP6 sequence calculated using Kimura 2-parameter modelindicated that the smallest genetic distance 0%, biggest 0.8% and average 0, 2%. The phylogenetic treeusing neighbor joining method based on the sequence of nucleotide ATP6 gene could not be used todifferentiate among T. Dianae (from Central Sulawesi), T. Spectrum (from North Sulawesi), T. bancanus(from lampung, South Sumatera) and T.bancanus from West Kalimantan.
Uji Toksisitas Akut Ekstrak Rimpang Kunyit pada Mencit : Kajian Histopatologis Lambung, Hati dan Ginjal (ACUTE ORAL TOXICITY OF TURMERIC EXTRACT IN MICE : HISTOPATHOLOGICAL STUDIES OF STOMACH, LIVER AND KIDNEY) Wiwin Winarsih; Ietje Wientarsih; Nova P. Sulistyawati; Istifharany Wahyudina
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (339.192 KB)

Abstract

This experiment was carried out to determine the mouse lethal dose (MLD50 of ethanolic extract ofthe turmeric (Curcuma longa) rhizomes following single oral administration and to evaluate thetoxicopathologic effects of the extract in certain organs ie stomach, liver and kidney. Forty five male micewere divided into nine groups. Four groups were treated orally with ethyl acetate fraction, four groups weretreated orally with hexane fraction of ethanolic turmeric extract, and one group was used as control. Theethyl acetate fraction groups were administered orally with the ethyl acetate fraction at doses of 7.5, 1.5,30 and 60 g/kg body weight. The hexane fraction groups were administered orally with the hexane fractionwith the dosage of 7,5, 15, 30 and 60 g/kg body weight. The control group received normal saline. MLD50 ofethyl acetate fraction was 27,98 gram/kg body weight by per oral administration. Oral MLD50 of hexanefraction was 19,50 gram/kg body weight. Histopathological features of the ethyl acetate and hexanefractions groups showed increased amount of parietal cells in stomach and parenchymal degeneration andnecrosis in their liver and kidney.
Sekuen Gen Surface Antigen-1 dan Bradizoit Antigen-1 Takizoit Toxoplasma gondii sebagai Kandidat Pemindai DNA (SAG1 AND BAG1 GENE SEQUENCES ANALYSIS OF TOXOPLASMA GONDII TACHYZOITE AS PROBE CANDIDATE) Ida Ayu Pasti Apsari; Wayan Tunas Artama; Sumartono .; I Made Damriyasa
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (344.34 KB)

Abstract

Sag1 and bag1 is a gene specific-stage for Toxoplasma gondii tachyzoite and bradyzoite. The purposeof this study was analyze the sequences of sag1 and bag1 tachyzoite genes of local of Toxoplasma gondiiisolate as deoxyribonucleic acid probe candidate. Tachyzoite of local of Toxoplasma gondii isolate used onthis study. Gene sag1 and bag1 gene of Toxoplasma gondii were amplified by PCR, and then sequenced. Theresults showed sag1 fragment gene contained 612 bp and bag 1 contained 470 bp in length. BLAST analysisof sag1 and bag1 gene fragments as probe candidate showed that high specific for Toxoplasma gondii andno significant cross-reaction fragment with host and other parasites. The sequences 136 bp and 98 bpfragments as DNA probe candidate of Toxoplasma gondii sag1 and bag1 respectively.
Isolasi, Identifikasi, Sifat Fisik, dan Biologi Virus Tetelo yang Diisolasi dari Kasus di Lapangan (ISOLATION, IDENTIFICATION, PHISICAL, AND BIOLOGICAL CHARACTER OF NEWCASTLE DISEASE VIRUS ISOLATED FROM FIELD CASES) Michael Haryadi Wibowo; Tri Untari; Anastasia Endang Tri Hastuti Wahyuni
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (166.32 KB)

Abstract

native chicken farm suspected to Newcastle disease (ND) virus infection. Specimens were taken andcollected from the lung was further processed. Suspected materials were inoculated into allantoic sacc inspecific pathogenic free of 10 days embryonating egg chicken. The growth of the virus was determined withthe ability to agglutinate the chicken red blood cells or hemaglutination test. Positive hemaglutinationwas performed with hemaglutinatin inhibition test using specific antibody against ND virus. Method forND virus isolation, propagation and identification were based on the standard procedure of serologicalidentification for ND virus serological identification. 13 out of 34 samples were identified as ND viruses.Observation on the course and time of the virus to kill the chicken embryo could be differentiated intomoderate virus patho-type were 10 isolates and a virulent strains were 3 isolates. Further characterizationbased on the elution time observation indicated 11 isolates were not pathogenic strain and 2 isolates werenot virulent strain. Hemagglutinin stability study revealed that 11 isolates were sensitive being heated at560C for 30 minutes while 2 isolates were resistant. Biological characteristic of ND virus to hemagglutinateon various mammalian red blood cells indicating that most isolates were HA negative. Two isolates wereHA positive with cattle, horse and sheep red blood cell, and one isolate indicated positive HA test by usingsheep red blood cell. Control virus was lentogenic patho-type of La Sota strain showed HA and HI testpositive, elution time was 29 minutes, stability on the hemagglutinin after heating was 2 minutes and HApositive with cattle, horse and sheep red blood cell.
Pneumonia Verminosa pada Kucing Lokal yang Terinfeksi oleh Aelurotsrongylus sp (VERMINOUS PNEUMONIA IN DOMESTIC CAT INFECTED BY AELUROSTRONGYLUS SP) Ida Bagus Oka Winaya; I Ketut Berata; I Made Kardena; Ida Bagus Made Oka
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (160.584 KB)

Abstract

The aim of the study was to evaluate the pulmo pathological changes of domestic cat infected byAelurostrongylus sp. A total of 15 cats were examined at Faculty of Veterinery Medicine, Udayana Universityduring 2010. Ten out of 15 cats showed sneezing, whereas the remains showed serous rhinitis and sneezing.Macroscopic and microscopic changes were observed mainly on pulmo samples. Hyperemias on caudalislobes and pleura effusion were found in the pulmo. The pulmo tissue was fixed on 10 % neutral bufferformalin and stained with haematoxilin-eosin (HE) for histopathological examination. Aelurostrongylus spwas present in the alveoli lumen of the lung samples. Meanwhile, the alveoli septa of the lung wereobserved thicker and infiltrated with neutrophils, plasma exudates and erythrocytes. Pleural effusion wasmainly consisted of eosinophilic substances. It is concluded that verminous pneumonia in domestic catinfected with Aelurostrongylus sp was an acute infection.
Identifikasi Leptin pada Kesembuhan Luka Tikus yang Diberi Pakan Lemak Tinggi dan Aplikasi Zinc Topikal (LEPTIN IDENTIFICATION ON WOUND HEALING OF RAT GIVEN HIGH FAT DIET AND TOPICAL ZINC APPLICATION) Devita Anggraeni; Dhirgo Adji; Bambang Sutrisno
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (311.099 KB)

Abstract

Leptin is a hormone produced by adipocytes and play an important role in wound healing. The objectiveof this research was to study the role of leptin in wound healing in mice experimentally given high fat dietsand its correlation to zinc. Thirty two male Sprague Dawley rats at three months of age were used in thisstudy. Rats were randomly allotted into four groups (A,B,C and D) of 8. Rats in group A and B were fednormal diet, while rats in group C and D were fed high fat diet. After two months of treatment, skin incisionsurgery was performed at the back side of the rat. Incision wound was closed with single interruptedsuture. The wound of rats in group A and C were treated with vaseline, while in the group B and D weretreated with zinc 10%. One day after surgery, blood sample were collected frpm four rats from each groupand analysed for leptin (Rat leptin ELISA Int, Genway Biotech Inc). Wounded skin from all animals werealso taken for histopathological examination (Haematoxylin and Eosin). Three days after the surgery, thesame analysis were done for the remaining rats. Leptin level was analyzed statistically using ANOVA forfactorial experiment, while histopathologic analysis was done descriptively. The results showed that theleptin level was significantly affected by time (P<0.05), as leptin level in blood at three days after surgerywas significantly lower than the level at one day after surgery. Meanwhile, histopathological examinationshowed that the percentage of epidermal closure in animals in group A,B,C,and D were 75%, 100%, 25%and 75%, respectivelly. Therefore, it was concluded that topical application of zinc might have significanteffect on the wound healing of the rats fed normal diets as well as these that given a high fat diet.
Kerugian Ekonomi Akibat Penyakit Rabies di Provinsi Nusa Tenggara Timur (ECONOMICAL LOSSES OF RABIES DISEASE IN EAST NUSA TENGGARA PROVINCE) Ewaldus Wera; Maria Geong; Maxs Urias Ebenhaizar Sanam
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (93.248 KB)

Abstract

The objective of this paper was to analyze economic impact of rabies in East Nusa Tenggara Province.Data from Health Department of East Nusa Tenggara Province (Period 1998-2007) were applied to a setof link the economics model. Analysis presented in this paper only costs related with PET, Vaccination andelimination of dogs. The total societal cost (PET in human) incurred by the disease was about Rp 19.9billion. The cost included transport cost to and from rabies-treatment centers, and loss of income whilereceiving treatment. The cost of vaccination was estimate about Rp 50.000 per dog and about 140.000dogs were vaccinated per year in the area. For this analysis, vaccination costs per dog included relatedcomponents on campaign organization, public awareness efforts, transport and biological and materialcosts. The economic losses due to the culling and vaccination program in dogs wes about Rp 5,3 and Rp 7billion per year, respectively. Total cost for vaccination and elimination of dog from 1998 through 2007 wasabout Rp 122,5 billion or Rp 12,3 billion per year. Total economic lost due to rabies in East Nusa TenggaraProvince during 1998-2007 was approximately 14,2 per year. The economic losses may be reduced byoptimalisation of rabies control in animal reservoir of rabies especially in dogs. The elimination of rabiesin dogs through mass vaccination with minimal coverage 70% of dog population is believed contribute tominimise rabies in human.
Suplementasi Ranggah Muda Rusa Sambar Memperbaiki Pertumbuhan Tulang Femur, Bobot Otot, dan Ketahanan Fisik Tikus Putih (THE EFFECT OF SAMBAR VELVET ANTLER SUPLEMENT ON FEMUR BONE, BODY GROWTH, AND PHYSICAL ENDURANCE IN RAT) Gono Semiadi; Raden Taufiq Purna Nugraha; Yuliasri Jamal
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (135.314 KB)

Abstract

Antlers are deer’s bony organ that follows a cycle of growing, hardening, casting and regroupingwithin a certain period. The effect of consuming velvet antler from temperate origin has beenknown scientifically to have positive effect for rheumatism and metabolic disorder sickness therapy.However, the role of velvet antler originated from tropical deer has not yet been explored. Thisstudy aimed to assess the potential of the velvet antler of sambar deer (Rusa unicolor) which wasexperimentally fed to laboratory rats. The assessment was made based on the animals growth rate(i.e. femur length, weight of testicle, body eight) and physical endurance (i.e. swimming test).Laboratory rats at 21 days old were allocated into four different groups and each group consisted offive rats were fed with powder of soft and hard parts of velvet antler at dose of 0, 1, 2, and 3 g/kgbody weight, respectively. Animals were examined for eight weeks the body weight was examinedweekly and the dose at velvet antler supplement was adjusted accordingly. At the end of the studythe rat were put on endurance swimming test and then euthanized, for measurement of femurbone length and weight of testis. The results showed that there were no differences in the bodyweight. However at dose of 2 g soft part/kg BW indicating a consistently higher live weight gainsacross the observation time. Testis weight showed no significant differences between the treatments,but the length of femur bone showed a significant effect (p <0.05) with the doses level, with thehighest score being at 3 g hard part / kg BW. Physical endurance showed a significant effect (p<0.05) with the doses level, with the level of 1 g soft part/kg BW gave the best performance.
Penurunan Osteoclast Epifysis Tulang Radius Mencit Perimenopause dengan Pemberian Estrogen dan Berenang (OSTEOCLAST COUNT DECREASING ON EPIPHYSIS PART OF RADIUS IN PERIMENOPAUSAL MICE ON ESTROGEN AND SWIMMING TREATMENT) Yuliana .; Ida Ayu Dewi Wiryanthini; Nyoman Mangku Karmaya; Tangking Widarsa
Jurnal Veteriner Vol 13 No 4 (2012)
Publisher : Faculty of Veterinary Medicine, Udayana University and Published in collaboration with the Indonesia Veterinarian Association

Show Abstract | Download Original | Original Source | Check in Google Scholar | Full PDF (196.731 KB)

Abstract

Increasing of life age expectancy has risen many health problem. One of the problem is osteoporosis.This disease can be prevented by estrogen and swimming treatment. Estrogen is not safe to be given inlong term. This study aim was to investigate the decreasing of osteoclast count in estrogen and swimmingtreatment. This study uded Pretest-Posttest Control Group Design with fifty two mice (15-16 months old).The mice were divided randomly into 4 groups, i.e. control, estrogen, swimming and combination group.After 90 days treatment, epiphysis of radius bone was sectioned and stained by haematoxyllin eosin.Osteoclast difference between groups were analyzed by using analysis of variance. Mean of osteoclast incontrol group was 0.12±0.1, and three other groups had the same level, i.e. 0,02±0,06. In conclusion, thedecrease of osteoclast count did not have any significant difference between treatment groups.

Page 1 of 2 | Total Record : 16

 1   2 

Filter by Year

2012 2012


Reset
Filter By Issues
All Issue Vol 24 No 1 (2023) Vol 23 No 4 (2022) Vol 23 No 3 (2022) Vol 23 No 2 (2022) Vol 23 No 1 (2022) Vol 22 No 4 (2021) Vol 22 No 3 (2021) Vol 22 No 2 (2021) Vol 22 No 1 (2021) Vol 21 No 4 (2020) Vol 21 No 3 (2020) Vol 21 No 2 (2020) Vol 21 No 1 (2020) Vol 20 No 4 (2019) Vol 20 No 3 (2019) Vol 20 No 2 (2019) Vol 20 No 1 (2019) Vol 19 No 4 (2018) Vol 19 No 3 (2018) Vol 19 No 2 (2018) Vol 19 No 1 (2018) Vol 18 No 4 (2017) Vol 18 No 3 (2017) Vol 18 No 2 (2017) Vol 18 No 1 (2017) Vol 17 No 4 (2016) Vol 17 No 3 (2016) Vol 17 No 2 (2016) Vol 17 No 1 (2016) Vol 16 No 4 (2015) Vol 16 No 3 (2015) Vol 16 No 2 (2015) Vol 16 No 1 (2015) Vol 15 No 4 (2014) Vol 15 No 3 (2014) Vol 15 No 2 (2014) Vol 15 No 1 (2014) Vol 14 No 4 (2013) Vol 14 No 3 (2013) Vol 14 No 2 (2013) Vol 14 No 1 (2013) Vol 13 No 4 (2012) Vol 13 No 3 (2012) Vol 13 No 2 (2012) Vol 13 No 1 (2012) Vol 12 No 4 (2011) Vol 12, No 3 (2011) Vol 12, No 2 (2011) Vol 12 No 1 (2011) Vol 11 No 4 (2010) Vol 11 No 3 (2010) Vol 11 No 2 (2010) Vol 11 No 1 (2010) Vol 10 No 4 (2009) Vol 10 No 3 (2009) Vol 10 No 2 (2009) Vol 10 No 1 (2009) Vol 9 No 4 (2008) Vol 9 No 3 (2008) Vol 9 No 2 (2008) Vol 9 No 1 (2008) Vol 8 No 4 (2007) Vol 8 No 2 (2007) Vol 8 No 1 (2007) Vol 7 No 4 (2006) Vol 4 No 2 (2003) Vol 4 No 1 (2003) Vol 2 No 4 (2001) Vol 2 No 3 (2001) Vol 2 No 2 (2001) Vol 2 No 1 (2001) Vol 1 No 1 (2000) More Issue